Fungi/ Fungal community
Beyond bacteria
Microeukaryotes—particularly fungi—play a major role in many ecosystems (e.g., aquatic sediments), in human health (namely as parasites), and in biotechnological processes (e.g., in food industry). We offer next-generation amplicon sequencing for 18S rRNA genes and ITS2 for taxonomic characterization of fungal and other microeukaryotic communities. (For functional aspects, we suggest a shotgun metagenomic approach.)
We recommend the following primer systems for amplification of different target regions:
| Primer Pair | Sequence | Target | Size (bp) | Reference |
|---|---|---|---|---|
| V8f
1510r |
ATAACAGGTCTGTGATGCCCT
CCTTCYGCAGGTTCACCTAC |
18S rRNA
V8-V9 |
~370 | Bradley et al. 2016 |
| ITS3
ITS4 |
GCATCGATGAAGAACGCAGC
TCCTCCGCTTATTGATATGC |
ITS2 | ~300-400 | Fujita et al. 2001 |
| gITS7
ITS4 |
GTGARTCATCGARTCTTTG
TCCTCCGCTTATTGATATGC |
ITS2 | ~230-330 | Ihrmark et al. 2012 |
Of course, we can employ any customized primer set upon request. We will also help you design optimal primers for targeting specific organisms.
Important note: For library preparation, the above primer sequences need to be combined with specific sequencing adapters. Sequencing will not work with amplicons produced with ordinary primers. Kindly provide us with DNA isolated from your microbial communities. Or simply send us your clinical or environmental samples for DNA isolation.
