Microeukaryotes

Beyond bacteria

Microeukaryotes—particularly fungi—play a major role in many ecosystems (e.g., aquatic sediments), in human health (namely as parasites), and in biotechnological processes (e.g., in food industry). We offer next-generation amplicon sequencing for 18S rRNA genes and ITS2 for taxonomic characterization of fungal and other microeukaryotic communities. (For functional aspects, we suggest a shotgun metagenomic approach.)

We recommend the following primer systems for amplification of different target regions:

Primer Pair Sequence Target Size (bp) Reference
V8f

1510r

ATAACAGGTCTGTGATGCCCT

CCTTCYGCAGGTTCACCTAC

18S rRNA

V8-V9

~370 Bradley et al. 2016
ITS3

ITS4

GCATCGATGAAGAACGCAGC

TCCTCCGCTTATTGATATGC

ITS2 ~300-400 Fujita et al. 2001
gITS7

ITS4

GTGARTCATCGARTCTTTG

TCCTCCGCTTATTGATATGC

ITS2 ~230-330 Ihrmark et al. 2012

Of course, we can employ any customized primer set upon request. We will also help you design optimal primers for targeting specific organisms.

Important note: For library preparation, the above primer sequences need to be combined with specific sequencing adapters. Sequencing will not work with amplicons produced with ordinary primers. Kindly provide us with DNA isolated from your microbial communities. Or simply send us your clinical or environmental samples for DNA isolation.